TF Info Page for MAFB (bZIP)
Conclusion
| Assessment | Binding Mode | Motif Status | Notes | Comments |
|---|---|---|---|---|
| Known motif | 1 Monomer or homomultimer | 100 perc ID - in vitro | PDB:2WTY is a homodimer crystallised with TAATTGCTGACTCAGCAAAT sequence |
Description
| Description: | MAF bZIP transcription factor B [Source:HGNC Symbol;Acc:HGNC:6408] | |
| Entrez Summary | TBA | |
| Ensembl ID: | ENSG00000204103 | |
| External Link: | T025325_1.02 | |
| Interpro | IPR004826; IPR004827; IPR008917; IPR013592; | |
| Protein Domain: | ||
| Protein: ENSP00000362410 | DBD: bZIP | Other: Maf_N |
Previous Annotations
| Source | Annotation |
| TF-CAT classification |
TF Gene_Transcription Factor Binding tf co-factor binding_TF PPI_ PMIDS:17158225 9571165 |
| Vaquerizas 2009 TF classification "a" Has direct evidence of TF function; "b" Has evidence for an orthologous TF; "c" contains likely DBDs, but has no functional evidence; "x" is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription; "other" category contains proteins without clear DBDs they curated from external sources. |
a |
| CisBP considers it as a TF? | Yes |
| TFclass considers it as a TF? | Yes |
| Has GO:0003700 "transcription factor activity, sequence-specific DNA binding" | Yes |
| GO-Info |
GO:0001077 RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor a IEA - GO_REF:0000019 GO:0001228 RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor IBA - GO_REF:0000033 |
|
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding; 1a2 There is high confidence data for a close ortholog (as defined in CisBP); 2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model; 2a2 There is lower confidence evidence for an close ortholog; 3a There is decent circumstantial evidence for its role as a TF or not; 4a Two or more datasets predict it as a TF; 5a One of the source datasets predicts is as a TF |
1a1, Direct HQ evidence |
| TF has conditional DNA-binding requirements |