TF Info Page for MAFB (bZIP)

Conclusion

Assessment Binding Mode Motif Status Notes Comments
Known motif 1 Monomer or homomultimer 100 perc ID - in vitro PDB:2WTY is a homodimer crystallised with TAATTGCTGACTCAGCAAAT sequence

Description

Description: MAF bZIP transcription factor B [Source:HGNC Symbol;Acc:HGNC:6408]
Entrez Summary The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that plays an important role in the regulation of lineage-specific hematopoiesis. The encoded nuclear protein represses ETS1-mediated transcription of erythroid-specific genes in myeloid cells. This gene contains no introns. [provided by RefSeq, Jul 2008]
Ensembl ID: ENSG00000204103
External Link: CisBP
Interpro IPR004826; IPR004827; IPR008917; IPR013592;
Protein Domain: ENSP00000362410
Domain:
Protein: ENSP00000362410DBD: bZIPOther: Maf_N

Previous Annotations

Source Annotation
TF-CAT classification TF Gene_Transcription Factor Binding
tf co-factor binding_TF PPI_
PMIDS:17158225 9571165
Vaquerizas 2009 TF classification
"a" Has direct evidence of TF function;
"b" Has evidence for an orthologous TF;
"c" contains likely DBDs, but has no functional evidence;
"x" is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription;
"other" category contains proteins without clear DBDs they curated from external sources.
a
CisBP considers it as a TF? Yes
TFclass considers it as a TF? Yes
Has GO:0003700 "transcription factor activity, sequence-specific DNA binding" Yes
GO-Info GO:0001077
RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor a
IEA - GO_REF:0000019
GO:0001228
RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor
IBA - GO_REF:0000033
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding;
1a2 There is high confidence data for a close ortholog (as defined in CisBP);
2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model;
2a2 There is lower confidence evidence for an close ortholog;
3a There is decent circumstantial evidence for its role as a TF or not;
4a Two or more datasets predict it as a TF;
5a One of the source datasets predicts is as a TF
1a1, Direct HQ evidence
TF has conditional DNA-binding requirements

DNA-Binding

Published Motif Data

Source Annotation Motif Evidence
TransfacTransfacLicense requiredDirect
TransfacTransfacLicense requiredDirect
MiscHocoMocoDirect
PBMBadis09Inferred - Mafb (100% AA Identity, Mus musculus)
SELEXJASPARInferred - Mafb (100% AA Identity, Mus musculus)
TransfacTransfacLicense requiredInferred - MAF_AVIS4 (79% AA Identity, Avian musculoaponeurotic fibrosarcoma virus AS42)
TransfacTransfacLicense requiredInferred - MAF_CHICK (79% AA Identity, Gallus gallus)
HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAF (77% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - MAFA (77% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - MAFA (77% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - MAFA (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAFA (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAFA (77% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - MAFA (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAF (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAF (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAF (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAFA (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAFA (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAFA (77% AA Identity, Homo sapiens)
TransfacTransfacLicense requiredInferred - MAFA (77% AA Identity, Homo sapiens)
MiscHocoMocoInferred - MAF (77% AA Identity, Homo sapiens)
MiscHocoMocoInferred - MAFA (77% AA Identity, Homo sapiens)
MiscHOMERInferred - Mafa (77% AA Identity, Mus musculus)
HT-SELEXYin2017Inferred - NRL (58% AA Identity, Homo sapiens)
HT-SELEXYin2017Inferred - NRL (58% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - NRL (58% AA Identity, Homo sapiens)
Methyl-HT-SELEXYin2017Inferred - NRL (58% AA Identity, Homo sapiens)

Structure

Structure PDB 2WTY

Experimental History

Method Constructs
Tried in PBM?
(Whether the protein was tried in PBM or not)
Tried in HT-SELEX
(Whether the protein was tried in HT-SELEX or not, and if so, then what kind of clones were tested)
Other Information?
(Tried with another method and failed?)

External Contribution