Collection of considered potential humanTFs (2765 proteins)

Ensembl ID HGNC symbol DBD Family Is TF? TF Assessment Binding Activity Motif Status Notes Comments
TFAP2A AP-2 Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TFAP2B AP-2 Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TFAP2C AP-2 Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TFAP2D AP-2 Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Binds the same GCCTGAGGC sequence as the other AP-2s (PMID: 24789576)
TFAP2E AP-2 Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ARID1A ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif Non-specific DNA binder (PMID: 15170388).
ARID1B ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif Non-specific DNA binder (PMID: 15170388).
ARID3A ARID/BRIGHT Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ARID3B ARID/BRIGHT Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ARID3C ARID/BRIGHT Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ARID4A ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif Has a putative AT-hook Binds DNA in a sequence non-specific manner (PMID: 15640446).
ARID4B ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif Binds DNA in a sequence non-specific manner (PMID: 15640446).
ARID5A ARID/BRIGHT Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ARID5B ARID/BRIGHT Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro Has a putative AT-hook
JARID2 ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif Only ARID3 and ARID5 family members have sequence specificity (PMID: 15640446).
KDM5A ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif
KDM5B ARID/BRIGHT Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds GC-rich sequences such as CCGCCC (PMID: 18270511).
KDM5C ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif
KDM5D ARID/BRIGHT No Unlikely to be sequence specific TF 3 Low specificity DNA-binding protein No motif Polycomb protein that is well-documented to bind histone marks (PMID: 27477906; PMID: 17351630; PMID: 17320160; PMID: 17320162).
ARID2 ARID/BRIGHT; RFX Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AHCTF1 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AHDC1 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AKNA AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds AT-rich promoters of CD40 and CD40L and coordinates their expression (PMID: 11268217).
ASH1L AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
CBX2 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
DNTTIP1 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
DOT1L AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
GLYR1 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
HMGA1 AT hook Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HMGA2 AT hook Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
PHF20 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PHF21A AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
PRR12 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
SCML4 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
SETBP1 AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Orthologous protein from mouse (Setbp1) bind DNA sequence-specifically by PBM
SRCAP AT hook Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
C11orf95 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
FAM200B BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
SGSM2 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBED1 BED ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBED2 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a BED domain that should bind DNA, but lacks the dimerization domain (PMID: 20016685).
ZBED3 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBED4 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBED5 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBED6 BED ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZBED8 BED ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Despite its name, does not have a detectable BED ZF domain.
ZBED9 BED ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AHR bHLH Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
AHRR bHLH Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ARNT bHLH Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ARNT2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ARNTL bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ARNTL2 bHLH Yes Inferred motif 2 Obligate heteromer High-throughput in vitro ARNTL2 Forms heterodimers with CLOCK and NPAS2 (PMID:10864977 ).
ASCL1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ASCL2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ASCL3 bHLH Yes Inferred motif 2 Obligate heteromer High-throughput in vitro ASCL1 heterodimerizes with TCF3; TCF4 and TCF12 (PMID: 24835951).
ASCL4 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro Probably heterodimerizes with TCF3; TCF4 or TCF12 like the other ASCL TFs
ASCL5 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro Probably heterodimerizes with TCF3; TCF4 or TCF12 like the other ASCL TFs
ATOH1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATOH7 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATOH8 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
BHLHA15 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BHLHA9 bHLH Yes Likely to be sequence specific TF 2 Obligate heteromer No motif Protein heterodimerizes with TCF3; TCF4 and TCF12 (PMID: 25466284).
BHLHE22 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BHLHE23 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BHLHE40 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BHLHE41 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CCDC169-SOHLH2 bHLH Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
CLOCK bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Can also bind as heterodimer with ARNTL.
EPAS1 bHLH Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
FERD3L bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FIGLA bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HAND1 bHLH Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Obligate heteromer (PMID: 10611232).
HAND2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HELT bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro Can form homodimers or heterodimers with HEY2 and HES5, suggesting also that the HELT homodimer is dependent of a additional Orange domain while the HEY2 heterodimer requires just the DBD (PMID: 14764602).
HES1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HES2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HES3 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
HES4 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
HES5 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HES6 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HES7 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Also forms heterodimers.
HEY1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HEY2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HEYL bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
HIF1A bHLH Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Binds as obligate heteromer with ARNT (PMID: 9027737).
HIF3A bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source Binds DNA as a heterodimer with ARNT and ARNT2; reviewed in (PMID: 24099156).
ID1 bHLH No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif ID bHLH proteins lack the basic region and should not be able to bind DNA. The HT-SELEX motif for ID4 is likely by a co-precipitated protein or it is a contamination
ID2 bHLH No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif ID bHLH proteins lack the basic region and should not be able to bind DNA. The HT-SELEX motif for ID4 is likely by a co-precipitated protein or it is a contamination
ID3 bHLH No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif ID bHLH proteins lack the basic region and should not be able to bind DNA. The HT-SELEX motif for ID4 is likely by a co-precipitated protein or it is a contamination
ID4 bHLH No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif ID bHLH proteins lack the basic region and should not be able to bind DNA. The HT-SELEX motif for ID4 is likely by a co-precipitated protein or it is a contamination
LYL1 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source TAL1, TAL2 and LYL are very similar and have a basic region with a bulky tryptophan inserting into the cluster of the basic residues. Binds DNA as a heterodimer with TCF3 (PDB:2YPB and PDB:2YPA).
MAX bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MESP1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MESP2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MITF bHLH Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro Binds DNA both as homo- and heterodimers (PMID: 23207919). The structure 4ATI is a homodimer with DNA GTTAGCACATGACCCT.
MLX bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MLXIP bHLH Yes Inferred motif 2 Obligate heteromer High-throughput in vitro
MLXIPL bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MNT bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Prefers to heterodimerize with MAX over homodimer formation (PMID: 9000049).
MSC bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MSGN1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MXD1 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source All three MXD proteins have very similar sequences and should behave accordingly, making heterodimers with at least MAX (PMID:8521822).
MXD3 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source All three MXD proteins have very similar sequences and should behave accordingly, making heterodimers with at least MAX (PMID:8521822).
MXD4 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source All three MXD proteins have very similar sequences and should behave accordingly, making heterodimers with at least MAX (PMID:8521822).
MXI1 bHLH Yes Known motif 2 Obligate heteromer In vivo/Misc source Has a putative AT-hook Obligate heteromer (PMID: 8425219).
MYC bHLH Yes Known motif 2 Obligate heteromer In vivo/Misc source Functions as a heterodimer with MAX.
MYCL bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source Similar to MYC and thus likely to functions as a heterodimer with MAX.
MYCN bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MYF5 bHLH Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
MYF6 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MYOD1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MYOG bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NCOA1 bHLH Yes Likely to be sequence specific TF 2 Obligate heteromer No motif NCOA1/2/3 all have been tested on PBMs and HT-SELEX without yielding a motif. All are co-activators, collectively suggesting they might be obligate heteromers.
NCOA2 bHLH Yes Likely to be sequence specific TF 2 Obligate heteromer No motif NCOA1/2/3 all have been tested on PBMs and HT-SELEX without yielding a motif. All are co-activators, collectively suggesting they might be obligate heteromers.
NCOA3 bHLH Yes Likely to be sequence specific TF 2 Obligate heteromer No motif NCOA1/2/3 all have been tested on PBMs and HT-SELEX without yielding a motif. All are co-activators, collectively suggesting they might be obligate heteromers.
NEUROD1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NEUROD2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NEUROD4 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
NEUROD6 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
NEUROG1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NEUROG2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NEUROG3 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
NHLH1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NHLH2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NPAS1 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source Likely obligate heteromer (PMID: 27782878).
NPAS2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NPAS3 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source Likely obligate heteromer (PMID: 9374395; PMID: 27782878).
NPAS4 bHLH Yes Inferred motif 2 Obligate heteromer High-throughput in vitro Likely dimerizes with ARNT2 (PMID:24263188).
OLIG1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OLIG2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro OLIG2 can homodimerize and heterodimerize with OLIG1 and NGN2 (PMID:15655114; PMID: 21382552).
OLIG3 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PTF1A bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SCX bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro SCX heterodimerizes with TCF3 (PMID: 19828133). The Taipale lab has an unpublished HT-SELEX model; both it and the inferred B1H motif seem very weak, supporting the idea that the homodimer does not bind DNA well.
SIM1 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source Similar to SIM2, which is a likely obligate heteromer.
SIM2 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source Likely obligate hetereomer (PMID: 7592839)
SOHLH1 bHLH Yes Likely to be sequence specific TF 2 Obligate heteromer No motif Forms SOHLH1-SOHLH2 heterodimers (PMID: 22056784).
SOHLH2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SREBF1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SREBF2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TAL1 bHLH Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain No motif yielded from PBMs or HT-SELEX. Binds DNA as heterodimer with TCF3 (PDB:2YPB and PDB:2YPA).
TAL2 bHLH Yes Inferred motif 2 Obligate heteromer In vivo/Misc source No motif yielded from PBMs or HT-SELEX. Similar to TAL1, which binds DNA as heterodimer with TCF3 (PDB:2YPB and PDB:2YPA).
TCF12 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TCF15 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
TCF21 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TCF23 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro Basic region is very similar to TCF21, which binds DNA as a homodimer in HT-SELEX.
TCF24 bHLH Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
TCF3 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TCF4 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TCFL5 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TFAP4 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Also can form heterodimers (PMID: 26550823).
TFE3 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TFEB bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TFEC bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TWIST1 bHLH Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Can form both homodimers and heterodimers with TCF3 (PMID: 16502419).
TWIST2 bHLH Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
USF1 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
USF2 bHLH Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Has a putative AT-hook
USF3 bHLH Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
POGK Brinker Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AC023509.3 bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro Identical bZIP DBD to ATF7. Some isoforms also contain a single C2H2 ZF. This is known to facilitate protein interactions in ATF7 (see ATF7 Uniprot page), so AC023509.3 is only classified here as a bZIP protein
APC2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
ATF1 bZIP Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ATF2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF4 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF5 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Transfac motifs dont correspond to canonical bZIP binding sites. Annotated as obligate heteromer based on peptide array studies (PMID:12805554).
ATF6 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF6B bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF7 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Some isoforms also contain a single C2H2 ZF. This is known to facilitate protein interactions (see Uniprot page), so ATF7 is only classified here as a bZIP protein
BACH1 bZIP Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
BACH2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Based on Newman et al 2003 (PMID: 12805554), the protein has strong preference for forming heterodimers with MAFG and MAFK over homo-dimerisation. The Homer ChIP-seq motif appears to be a MAF-BACH2 heterodimer.
BATF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Prefers to heterodimerize, but it has an HT-SELEX (homodimer) motif. Its homodimerization Kd is 184nM and its best heterodimer is with CEBPG (<1nM) (PMID: 23661758).
BATF2 bZIP Yes Likely to be sequence specific TF 2 Obligate heteromer No motif Part of AP-1 complex - there is no evidence it can bind on its own as a homodimer.
BATF3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Transfac motif is dubious.
BEND4 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Lacks the basic region of the bZIP domain.
CCDC3 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif bZIP domain is truncated and lacks the DNA-contacting residues.
CCDC83 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif bZIP domains are truncated, such that they are likely just coiled-coiled regions with no DNA-binding ability.
CEBPA bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
CEBPB bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CEBPD bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro CEBPD binds as both a homodimer and as a heterdimer with other C/EBP TFs (PMID: 1884998; PMID: 12805554).
CEBPE bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Also forms heterodimers.
CEBPG bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB3L1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB3L2 bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
CREB3L3 bZIP Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Gel-shift and reporter experiments demonstrate that CREB3L3 is a TF (PMID: 11353085).
CREB3L4 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB5 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREBL2 bZIP Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
CREBRF bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Tested on HT-SELEX and did not yield a motif. Binds to CREB3 and represses the unfolded protein response (PMID: 18391022).
CREBZF bZIP Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
CREM bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
DBP bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
DDIT3 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Has strong preference for forming heterodimers with BATF; DBP; HLF; CEBP[ABCD] over homodimerization (PMID: 12805554).
FOS bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FOSB bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FOSL1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FOSL2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Also forms heterodimers.
GULP1 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
HLF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HOOK2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
IQGAP1 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif bZIP domain in the protein is just a fragment.
JDP2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
JUN bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
JUNB bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Prefers forming heterodimers with FOS; FOSB; FOSL1 and FOSL2 over homodimers (PMID:12805554); but, clearly can bind DNA specifically in vitro.
JUND bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KIF15 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Has a bZIP like fragment that lacks the basic region required for DNA binding and a STE-domain that is classified as a potential DBD in CIS-BP. It is a kinesin operating in the microtubule system (PMID: 24419385)
KRT13 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
MAF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFA bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFB bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro PDB:2WTY is a homodimer crystallised with TAATTGCTGACTCAGCAAAT sequence
MAFF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFG bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFK bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MORC3 bZIP No ssDNA/RNA binding 4 Not a DNA binding protein No motif Lacks a canonical bZIP DBD but: regulates TP53 activity (PMID: 17332504]), binds RNA in vitro (PMID: 11927593), and may be required for influenza A transcription during viral infection (PMID: 26202233).
NDC80 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
NFE2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NFE2L1 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Tested on HT-SELEX and PBM. Neither yielded a motif. Likely an obligate heteromer (PMID: 23661758).
NFE2L2 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Has been tested by both PBM and HT-SELEX. Neither yielded a motif. Likely obligate heteromer.
NFE2L3 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Tested on HT-SELEX and PBM. Neither yielded a motif. Likely an obligate heteromer (PMID: 23661758). Strong preference for forming heterodimers with MAFG and MAFK over homodimers (PMID: 12805554).
NFIL3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NRBF2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
NRL bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PPP1R21 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Protein lacks the basic region these proteins use to contact the DNA
RAB11FIP4 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Likely false-positive - appears to function primarily in the cytoplasm (PMID: 12470645).
RNF219 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Not a proper bZIP; contains only a small leucine zipper region but lacks the DNA-interfacing basic part.
SCOC bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Not a proper bZIP; contains only a small leucine zipper region but lacks the DNA-interfacing basic part.
TEF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TRAK2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif The bZIP domain is only a partial 40AA sequence that will not bind DNA.
XBP1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
AC008770.3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AC092835.1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif KRAB C2H2 Protein
AC138696.1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
AEBP2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AKAP8 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain (PMID: 26683827) uses SELEX to show binding to G/C rich DNA, and confirms association with rDNA promoters. Also claims it has a C2H2 domain. Interpro says it has a C2H2 AKAP95-type 1 and a C2H2 AKAP95-type 2 domain. SMART does identify a single C2H2 domain.
AKAP8L C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain This is homologous to the AKAP8/AKAP95 protein. which has been shown by SELEX to bind GC rich sequences (PMID: 26683827).
ANKZF1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ATMIN C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
BCL11A C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
BCL11B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BCL6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BCL6B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BNC1 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
BNC2 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source Has a putative AT-hook
CASZ1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
CCDC17 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
CHAMP1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
CPXCR1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
CTCF C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Has a putative AT-hook
CTCFL C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
DPF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro This protein contains C2H2 ZFs missed by Pfam scanning.
DPF3 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro Single C2H2 domain Single C2H2 ZF. PHD domains mediate recognition of acetylated histones (PMID: 20613843); unclear if the ZF contributes DNA-binding specificity to the interaction.
DZIP1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain; Has a putative AT-hook
E4F1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
EEA1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Based on (PMID: 20534488), the protein has a C2H2 ZF domain; but it uses the domain for contacting RAB5A rather than for binding DNA.
EGR1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
EGR2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Binds HOX4A promoter (PMID:21836637)
EGR3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
EGR4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FAM170A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Degenerate C2H2-ZFP. Localizes to the nucleus and overexpression upregulates other genes (PMID: 20162441).
FEZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
FEZF2 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
FIZ1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Protein has a decent cassette of C2H2 ZF domains (not all are detected by Pfam). It has been also shown to interact with homeodomain protein CRX (PMID: 18854042) and MAF-subtype bZIP protein NRL (PMID: 12566383).
GFI1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GFI1B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLI1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
GLI2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLI3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLI4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect Protein is not closely homologous to GLI1-3 proteins.
GLIS1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLIS2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLIS3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GTF3A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
GZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HIC1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HIC2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HINFP C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HIVEP1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HIVEP2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HIVEP3 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source Has a putative AT-hook Binds to NFKB-like consensus sequence to repress transcription (PMID: 21189157). PWMs for HIVEP1 and 2 in Transfac and Hocomoco are also NFKB-like.
HKR1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
IKZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
IKZF2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
IKZF3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
IKZF4 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
IKZF5 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
INSM1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
INSM2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
JAZF1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
KAT7 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
KCMF1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain No evidence of DNA-binding in the literature; and has evidence of E3 ligase activity (PMID:15581609).
KIN C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Binds curved DNA (PMID: 8078469).
KLF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF10 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF11 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF13 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF15 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF16 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF17 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Binds as a monomer and as a dimer (PMID: 25575120).
KLF6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF7 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
KLF8 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
KLF9 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
L3MBTL1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Histone modifier; polycomb protein.
L3MBTL3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Histone modifier; polycomb protein.
L3MBTL4 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Histone modifier; polycomb protein.
MAZ C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
MECOM C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
MTF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MYNN C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
MYT1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Crystal structure (PDB:2JX1) has GTGAACTTTCGGT DNA; similar to MYT1L SELEX and PBM sites.
MYT1L C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
MZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
NUFIP1 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif Single C2H2 domain This is a known RNA-binding protein with a single C2H2 domain. TF-CAT considered it a candidate TF; but in the ten years since; no such evidence has emerged.
OSR1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OSR2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OVOL1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OVOL2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OVOL3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PEG3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif SCAN C2H2 ZF Protein.
PLAG1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PLAGL1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
PLAGL2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PRDM1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PRDM10 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
PRDM12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
PRDM13 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PRDM14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
PRDM15 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
PRDM16 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
PRDM2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has been suggested to function as a histone methyltransferase (PMID: 15282304), but it has a decent set of C2H2 ZF domains and could thus bind DNA independently.
PRDM4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PRDM5 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a nice cassette of C2H2 ZF domains. Moreover, (PMID: 17636019) has performed SELEX for it and validated the result.
PRDM6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
PRDM8 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PRDM9 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
PRMT3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Has a single C2H2 ZF (PMID: 10931850).
RBAK C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
RBSN C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Potential false positive - protein functions in membrane trafficking.
REPIN1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds DNA specifically based on EMSA and nuclease footprinting (PMID: 10606657).
REST C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
RLF C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
RREB1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
SALL1 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
SALL2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
SALL3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
SALL4 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
SCRT1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SCRT2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SLC2A4RG C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Two papers demonstrate a bit of evidence for DNA binding (PMID:10825161 and PMID: 14625278 ).
SNAI1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SNAI2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SNAI3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Transfac motif has some similarity to known Sp1 TF motifs from multiple species and sources
SP6 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
SP7 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
SP8 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP9 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ST18 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
TRAFD1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Possible false positive: the protein negatively regulates IRF3 and NFKB but there is no evidence for DNA-binding and it is likely to operate upstream on the signalling cascade (PMID:18849341).
TSHZ1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
TSHZ2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Also contains an atypical homodomain (Uniprot) not identified by Pfam.
TSHZ3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif The C2H2 domains are too spread out to be credible; but there is also a homodomain. Seems more likely than not that it binds DNA.
VEZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
WIZ C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook Regulates the G9aGLP complex for gene repression; has a ChIP-seq derived DNA-binding motif (PMID:25789554).
WT1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Crystal structure (PDB:2JP9) is with dsDNA GCGCAGACGCCCCCGCG, which is consistent with the PWMs
YY1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
YY2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ZBTB10 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB11 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZBTB12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB16 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZBTB17 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB18 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB20 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB21 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB22 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB25 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB26 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ZBTB32 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB33 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
ZBTB34 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB37 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB38 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif It has a decent cassette of znfC2H2 domains and a BTB homodimerization domain. Requires CpG methylation for binding into a site in MYOG-promoter (PMID: 21625269).
ZBTB39 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZBTB40 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB41 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB42 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZBTB43 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB44 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB45 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB46 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Specificity is unknown; functions in dendritic cells (PMID: 22615130).
ZBTB47 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB48 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZBTB49 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB5 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Binds to GATCGGGCGGGGCGGTTGTATATCA; GATCCGTTAGAGGAAGAAGACTGGGCATGTCTG and GATCCATCAGGAACATGTCCCAACATGTTGAGCTC based on EMSA using recombinant protein (PMID: 19491398).
ZBTB6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZBTB7A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB7B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB7C C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB8A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a two znfC2H2 domains and a BTB-domain
ZBTB8B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB9 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has two znfC2H2 domains and a BTB-domain that typically mediates homotypic dimerization
ZFAT C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
ZFP1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZFP14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP2 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZFP28 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE); Has a putative AT-hook
ZFP3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP30 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ZFP37 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZFP41 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZFP42 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZFP57 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect Recognizes CpG methylated ACTGCGGCAAT site based on structure 4GZN
ZFP62 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZFP64 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZFP69 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP69B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP82 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP90 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP91 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible false positive. An Atypical E3 ubiquitin-protein ligase that mediates Lys-63-linked ubiquitination of MAP3K14/NIK; leading to stabilization and activation of MAP3K14/NIK. It thereby acts as an activator of the non-canonical NF-kappa-B2/NFKB2 pathway (PMID: 20682767).
ZFP92 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZFPL1 C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Protein is a Golgi apparatus integral membrane protein with RING-type zinc fingers (PMID:18323775 ).
ZFPM1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZFPM2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif FOG-proteins use some of their zinc-fingers to interact with the GATA proteins. Other C2H2 ZFs are probably also capable of binding DNA (PMID: 10329627).
ZFR C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif
ZFR2 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif ZFR2 contains only RNA-binding zinc fingers
ZFX C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZFY C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZIC1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIC2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ZIC3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIC4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIC5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIK1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZIM2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect Binds GKGGSWST consensus with GTGGCAGT as the optimal site based on competition EMSA (PMID: 26692216).
ZIM3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZKSCAN1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZKSCAN2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZKSCAN3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZKSCAN4 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZKSCAN5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZKSCAN7 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZKSCAN8 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZMAT1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Possible RBP.
ZMAT3 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif Protein binds RNA (PMID: 19805223 and PMID: 16844115).
ZMAT4 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible RBP.
ZNF10 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF100 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF101 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF106 C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif C2H2 ZFs are not present in most isoforms; of which most contain WD40 repeats. Previous annotations (TFCat) suggest role as a cofactor (PMID: 15833274).
ZNF107 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF112 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a nice cassette of znfC2H2 domains and a KRAB-domain; virtually nothing is known about it.
ZNF114 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF117 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZNF12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF121 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF124 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF131 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Evidence for DNA binding (PMID: 20303951 ).
ZNF132 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF133 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF134 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF135 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF136 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF138 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF14 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF140 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF141 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF142 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF143 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF146 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF148 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF154 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF155 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF157 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF16 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF160 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF165 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a SCAN-domain and that it appears to be expressed commonly in urinary bladder cancers PMID: 25214475
ZNF169 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF17 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF174 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF175 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF177 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF18 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF180 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF181 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF182 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF184 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF189 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF19 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF195 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Kruppel family C2H2 ZF.
ZNF197 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF20 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF200 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF202 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF205 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF207 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF208 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF211 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF212 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF213 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE); Has a putative AT-hook
ZNF214 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF215 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF217 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Based on (PDB: 3UK3) this protein has at least two DNA binding znf domains. In vitro evidence for DNA binding (PMID:17130829).
ZNF219 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Binds CCCCCA based on SELEX (PMID: 14621294).
ZNF22 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF221 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF222 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF223 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF224 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF225 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF226 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF227 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF229 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF23 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF230 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has nice array of znf domains and a KRAB domain
ZNF232 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF233 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF234 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF235 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF236 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF239 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds TAAAGGCT based on EMSA (PMID: 11278819).
ZNF24 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF248 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF25 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF250 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF251 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF253 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF254 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF256 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF257 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF26 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF260 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF263 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF264 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF266 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF267 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF268 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Contains znfC2H2 domains and a KRAB-domain; linked to cervical cancer through effects on NFKB-signaling (PMID: 23091055).
ZNF273 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF274 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF275 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF276 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF28 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF280A C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF280B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF280C C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF280D C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF281 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF282 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF283 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF284 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF285 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF286A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF286B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF287 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF292 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF296 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF30 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF300 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF302 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF304 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF311 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF316 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF317 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF318 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible RNA-binding protein; it has two u1 type ZNF domains (PMID: 25057009).
ZNF319 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF32 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF320 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF322 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF324 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF324B C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF326 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif ZNF326 is a member of the DBIRD complex that regulates splicing by binding to PolII in an RNA-independant manner (PMID:22446626).