Conclusion
Assessment
Binding Mode
Motif Status
Notes
Comments
Likely to be sequence specific TF
1 Monomer or homomultimer
No motif
Binds GATCCGCCCGCTTGTGGCCAACTGGCTCCAGTCAC dsDNA based on EMSA (PMID: 18021396)
Description
Description:
glycosylated lysosomal membrane protein [Source:HGNC Symbol;Acc:HGNC:29436]
Entrez Summary
#!usr/local/bin/perl
?>
Involved in positive regulation of transcription by RNA polymerase
II. Located in cytosol; lysosome; and nucleus. [provided by Alliance of
Genome Resources, Apr 2022]
Ensembl ID:
ENSG00000198715
External Link:
CisBP
Interpro
IPR029382 ;
Protein Domain:
ENSP00000354553
Protein Domain:
ENSP00000480936
Protein Domain:
ENSP00000479149
Protein Domain:
ENSP00000477187
Domain:
Protein: ENSP00000354553DBD: OtherOther: NCU-G1Protein: ENSP00000480936DBD: OtherOther: NCU-G1Protein: ENSP00000479149DBD: OtherOther: NCU-G1Protein: ENSP00000477187DBD: OtherOther: NCU-G1
Previous Annotations
Source
Annotation
TF-CAT classification
No PMIDS:
Vaquerizas 2009 TF classification
"a " Has direct evidence of TF function;
"b " Has evidence for an orthologous TF;
"c " contains likely DBDs, but has no functional evidence;
"x " is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription;
"other " category contains proteins without clear DBDs they curated from external sources.
No
CisBP considers it as a TF?
No
TFclass considers it as a TF?
No
Has GO:0003700 "transcription factor activity, sequence-specific DNA binding"
Yes
GO-Info
GO:0003700 sequence-specific DNA binding transcription factor activity IMP - PMID:18021396 GO:0004879 ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity IMP - PMID:18021396
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding;
1a2 There is high confidence data for a close ortholog (as defined in CisBP);
2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model;
2a2 There is lower confidence evidence for an close ortholog;
3a There is decent circumstantial evidence for its role as a TF or not;
4a Two or more datasets predict it as a TF;
5a One of the source datasets predicts is as a TF
5a, one of the source datasets predicts is as a TF
TF has conditional DNA-binding requirements
DNA-Binding
Published Motif Data
Structure
Experimental History
{"regions": [{"startStyle": "straight", "end": 399, "endStyle": "straight", "aliStart": 55, "text": "NCU-G1", "colour": "#9999ff", "aliEnd": 397, "start": 55, "href": "http://pfam.xfam.org/family/PF15065.4", "type": "pfama", "display": "true", "metadata": {"end": 399, "description": "NCU-G1 is a set of highly conserved nuclear proteins rich in proline with a molecular weight of approximately 44 kDa. Especially high levels are detected in human prostate, liver and kidney. NCU-G1 is a dual-function family capable of functioning as a transcription factor as well as a nuclear receptor co-activator by stimulating the transcriptional activity of peroxisome proliferator-activated receptor-alpha (PPAR-alpha) [1].", "database": "PfamA", "aliStart": 55, "scoreName": "E-value", "accession": "PF15065.4", "start": 55, "score": 2.0999999999999996e-98, "identifier": "Lysosomal transcription factor, NCU-G1", "type": "DBD", "aliEnd": 397}}], "length": 407}
{"regions": [{"startStyle": "straight", "end": 318, "endStyle": "straight", "aliStart": 1, "text": "NCU-G1", "colour": "#9999ff", "aliEnd": 316, "start": 1, "href": "http://pfam.xfam.org/family/PF15065.4", "type": "pfama", "display": "true", "metadata": {"end": 318, "description": "NCU-G1 is a set of highly conserved nuclear proteins rich in proline with a molecular weight of approximately 44 kDa. Especially high levels are detected in human prostate, liver and kidney. NCU-G1 is a dual-function family capable of functioning as a transcription factor as well as a nuclear receptor co-activator by stimulating the transcriptional activity of peroxisome proliferator-activated receptor-alpha (PPAR-alpha) [1].", "database": "PfamA", "aliStart": 1, "scoreName": "E-value", "accession": "PF15065.4", "start": 1, "score": 1.7999999999999996e-85, "identifier": "Lysosomal transcription factor, NCU-G1", "type": "DBD", "aliEnd": 316}}], "length": 326}
{"regions": [{"startStyle": "jagged", "end": 313, "endStyle": "straight", "aliStart": 40, "text": "NCU-G1", "colour": "#9999ff", "aliEnd": 311, "start": 38, "href": "http://pfam.xfam.org/family/PF15065.4", "type": "pfama", "display": "true", "metadata": {"end": 313, "description": "NCU-G1 is a set of highly conserved nuclear proteins rich in proline with a molecular weight of approximately 44 kDa. Especially high levels are detected in human prostate, liver and kidney. NCU-G1 is a dual-function family capable of functioning as a transcription factor as well as a nuclear receptor co-activator by stimulating the transcriptional activity of peroxisome proliferator-activated receptor-alpha (PPAR-alpha) [1].", "database": "PfamA", "aliStart": 40, "scoreName": "E-value", "accession": "PF15065.4", "start": 38, "score": 3.899999999999999e-71, "identifier": "Lysosomal transcription factor, NCU-G1", "type": "DBD", "aliEnd": 311}}], "length": 321}
{"regions": [{"startStyle": "jagged", "end": 24, "endStyle": "jagged", "aliStart": 4, "text": "NCU-G1", "colour": "#9999ff", "aliEnd": 20, "start": 2, "href": "http://pfam.xfam.org/family/PF15065.4", "type": "pfama", "display": "true", "metadata": {"end": 24, "description": "NCU-G1 is a set of highly conserved nuclear proteins rich in proline with a molecular weight of approximately 44 kDa. Especially high levels are detected in human prostate, liver and kidney. NCU-G1 is a dual-function family capable of functioning as a transcription factor as well as a nuclear receptor co-activator by stimulating the transcriptional activity of peroxisome proliferator-activated receptor-alpha (PPAR-alpha) [1].", "database": "PfamA", "aliStart": 4, "scoreName": "E-value", "accession": "PF15065.4", "start": 2, "score": 3.8e-27, "identifier": "Lysosomal transcription factor, NCU-G1", "type": "DBD", "aliEnd": 20}}, {"startStyle": "jagged", "end": 104, "endStyle": "straight", "aliStart": 21, "text": "NCU-G1", "colour": "#9999ff", "aliEnd": 102, "start": 20, "href": "http://pfam.xfam.org/family/PF15065.4", "type": "pfama", "display": "true", "metadata": {"end": 104, "description": "NCU-G1 is a set of highly conserved nuclear proteins rich in proline with a molecular weight of approximately 44 kDa. Especially high levels are detected in human prostate, liver and kidney. NCU-G1 is a dual-function family capable of functioning as a transcription factor as well as a nuclear receptor co-activator by stimulating the transcriptional activity of peroxisome proliferator-activated receptor-alpha (PPAR-alpha) [1].", "database": "PfamA", "aliStart": 21, "scoreName": "E-value", "accession": "PF15065.4", "start": 20, "score": 3.8e-27, "identifier": "Lysosomal transcription factor, NCU-G1", "type": "DBD", "aliEnd": 102}}], "length": 112}