TF Info Page for GLMP (Unknown)

Conclusion

Assessment Binding Mode Motif Status Notes Comments
Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds GATCCGCCCGCTTGTGGCCAACTGGCTCCAGTCAC dsDNA based on EMSA (PMID: 18021396)

Description

Description: glycosylated lysosomal membrane protein [Source:HGNC Symbol;Acc:HGNC:29436]
Entrez Summary NA
Ensembl ID: ENSG00000198715
External Link: CisBP
Interpro IPR029382;
Protein Domain: ENSP00000354553
Protein Domain: ENSP00000480936
Protein Domain: ENSP00000479149
Protein Domain: ENSP00000477187
Domain:
Protein: ENSP00000354553DBD: OtherOther: NCU-G1
Protein: ENSP00000480936DBD: OtherOther: NCU-G1
Protein: ENSP00000479149DBD: OtherOther: NCU-G1
Protein: ENSP00000477187DBD: OtherOther: NCU-G1

Previous Annotations

Source Annotation
TF-CAT classification No
PMIDS:
Vaquerizas 2009 TF classification
"a" Has direct evidence of TF function;
"b" Has evidence for an orthologous TF;
"c" contains likely DBDs, but has no functional evidence;
"x" is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription;
"other" category contains proteins without clear DBDs they curated from external sources.
No
CisBP considers it as a TF? No
TFclass considers it as a TF? No
Has GO:0003700 "transcription factor activity, sequence-specific DNA binding" Yes
GO-Info GO:0003700
sequence-specific DNA binding transcription factor activity
IMP - PMID:18021396
GO:0004879
ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity
IMP - PMID:18021396
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding;
1a2 There is high confidence data for a close ortholog (as defined in CisBP);
2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model;
2a2 There is lower confidence evidence for an close ortholog;
3a There is decent circumstantial evidence for its role as a TF or not;
4a Two or more datasets predict it as a TF;
5a One of the source datasets predicts is as a TF
5a, one of the source datasets predicts is as a TF
TF has conditional DNA-binding requirements

DNA-Binding

Published Motif Data

Source Annotation Motif Evidence

Structure

Structure PDB Not_Covered

Experimental History

Method Constructs
Tried in PBM?
(Whether the protein was tried in PBM or not)
Tried in HT-SELEX
(Whether the protein was tried in HT-SELEX or not, and if so, then what kind of clones were tested)
Other Information?
(Tried with another method and failed?)

External Contribution