TF Info Page for GLMP (Unknown)
Conclusion
| Assessment | Binding Mode | Motif Status | Notes | Comments |
|---|---|---|---|---|
| Likely to be sequence specific TF | 1 Monomer or homomultimer | No motif | Binds GATCCGCCCGCTTGTGGCCAACTGGCTCCAGTCAC dsDNA based on EMSA (PMID: 18021396) |
Description
| Description: | glycosylated lysosomal membrane protein [Source:HGNC Symbol;Acc:HGNC:29436] | |
| Entrez Summary | TBA | |
| Ensembl ID: | ENSG00000198715 | |
| External Link: | ||
| Interpro | IPR029382; | |
| Protein Domain: | ||
| Protein: ENSP00000354553 | DBD: Other | Other: NCU-G1 |
| Protein: ENSP00000480936 | DBD: Other | Other: NCU-G1 |
| Protein: ENSP00000479149 | DBD: Other | Other: NCU-G1 |
| Protein: ENSP00000477187 | DBD: Other | Other: NCU-G1 |
Previous Annotations
| Source | Annotation |
| TF-CAT classification |
No PMIDS: |
| Vaquerizas 2009 TF classification "a" Has direct evidence of TF function; "b" Has evidence for an orthologous TF; "c" contains likely DBDs, but has no functional evidence; "x" is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription; "other" category contains proteins without clear DBDs they curated from external sources. |
No |
| CisBP considers it as a TF? | No |
| TFclass considers it as a TF? | No |
| Has GO:0003700 "transcription factor activity, sequence-specific DNA binding" | Yes |
| GO-Info |
GO:0003700 sequence-specific DNA binding transcription factor activity IMP - PMID:18021396 GO:0004879 ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity IMP - PMID:18021396 |
|
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding; 1a2 There is high confidence data for a close ortholog (as defined in CisBP); 2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model; 2a2 There is lower confidence evidence for an close ortholog; 3a There is decent circumstantial evidence for its role as a TF or not; 4a Two or more datasets predict it as a TF; 5a One of the source datasets predicts is as a TF |
5a, one of the source datasets predicts is as a TF |
| TF has conditional DNA-binding requirements |