TF Info Page for ZBTB5 (C2H2 ZF)


Assessment Binding Mode Motif Status Notes Comments
Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Binds to GATCGGGCGGGGCGGTTGTATATCA; GATCCGTTAGAGGAAGAAGACTGGGCATGTCTG and GATCCATCAGGAACATGTCCCAACATGTTGAGCTC based on EMSA using recombinant protein (PMID: 19491398).


Description: zinc finger and BTB domain containing 5 [Source:HGNC Symbol;Acc:HGNC:23836]
Entrez Summary NA
Ensembl ID: ENSG00000168795
External Link: CisBP
Interpro IPR000210; IPR007087; IPR011333; IPR013069; IPR015880; ;
Protein Domain: ENSP00000307604
Protein: ENSP00000307604DBD: C2H2 ZF Containing ProteinsOther: BTB, DUF3342, zf-C2H2_4, zf-H2C2_2

Previous Annotations

Source Annotation
TF-CAT classification No
Vaquerizas 2009 TF classification
"a" Has direct evidence of TF function;
"b" Has evidence for an orthologous TF;
"c" contains likely DBDs, but has no functional evidence;
"x" is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription;
"other" category contains proteins without clear DBDs they curated from external sources.
CisBP considers it as a TF? Yes
TFclass considers it as a TF? Yes
Has GO:0003700 "transcription factor activity, sequence-specific DNA binding" No
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding;
1a2 There is high confidence data for a close ortholog (as defined in CisBP);
2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model;
2a2 There is lower confidence evidence for an close ortholog;
3a There is decent circumstantial evidence for its role as a TF or not;
4a Two or more datasets predict it as a TF;
5a One of the source datasets predicts is as a TF
4a, two or more datasets predict it as a TF
TF has conditional DNA-binding requirements


Published Motif Data

Source Annotation Motif Evidence


Structure PDB Not_Covered

Experimental History

Method Constructs
Tried in PBM?
(Whether the protein was tried in PBM or not)
Tried in HT-SELEX
(Whether the protein was tried in HT-SELEX or not, and if so, then what kind of clones were tested)
Other Information?
(Tried with another method and failed?)

External Contribution