get eID DUX1_HUMAN else done selects
| Assessment | Binding Mode | Motif Status | Notes | Comments |
|---|---|---|---|---|
| Known motif | 1 Monomer or homomultimer | In vivo/Misc source | Only known motifs are from Transfac or HocoMoco - origin is uncertain | Not included in Ensembl. Binds GATCTGAGTCTAATTGAGAATTACTGTAC in EMSA (PMID: 9736770) |
| Description: | |
| Entrez Summary | TBA |
| Ensembl ID: | DUX1_HUMAN |
| External Link: | |
| Interpro | ; |
| Domain: |
|
| Source | Annotation |
| TF-CAT classification |
PMIDS: |
| Vaquerizas 2009 TF classification "a" Has direct evidence of TF function; "b" Has evidence for an orthologous TF; "c" contains likely DBDs, but has no functional evidence; "x" is an unlikely TF such as predicted gene, genes with likely non-specific DBDs or that have function outside transcription; "other" category contains proteins without clear DBDs they curated from external sources. |
|
| CisBP considers it as a TF? | |
| TFclass considers it as a TF? | Yes |
| Has GO:0003700 "transcription factor activity, sequence-specific DNA binding" | |
| GO-Info | |
|
Initial Assessment
1a1 Protein has a high confidence PWM (HT-SELEX, PBM or B1H model) or there is a crystal structure that supports sequence specific DNA binding; 1a2 There is high confidence data for a close ortholog (as defined in CisBP); 2a1 There is lower confidence direct evidence, such as a Jaspar, Hocomoco or Transfac model; 2a2 There is lower confidence evidence for an close ortholog; 3a There is decent circumstantial evidence for its role as a TF or not; 4a Two or more datasets predict it as a TF; 5a One of the source datasets predicts is as a TF |
|
| TF has conditional DNA-binding requirements |