Collection of 54 putative bZIP human TFs out of 72 considered proteins

DBD Alignment (Click to open/enlarge)


Click to download Alignment and Tree
Description
 Structure
Ensembl ID HGNC symbol DBD Family Is TF? TF Assessment Binding Mode Motif Status Notes Comments
AC023509.3 bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro Identical bZIP DBD to ATF7. Some isoforms also contain a single C2H2 ZF. This is known to facilitate protein interactions in ATF7 (see ATF7 Uniprot page), so AC023509.3 is only classified here as a bZIP protein
APC2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
ATF1 bZIP Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ATF2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF4 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF5 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Transfac motifs dont correspond to canonical bZIP binding sites. Annotated as obligate heteromer based on peptide array studies (PMID:12805554).
ATF6 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF6B bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ATF7 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Some isoforms also contain a single C2H2 ZF. This is known to facilitate protein interactions (see Uniprot page), so ATF7 is only classified here as a bZIP protein
BACH1 bZIP Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
BACH2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Based on Newman et al 2003 (PMID: 12805554), the protein has strong preference for forming heterodimers with MAFG and MAFK over homo-dimerisation. The Homer ChIP-seq motif appears to be a MAF-BACH2 heterodimer.
BATF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Prefers to heterodimerize, but it has an HT-SELEX (homodimer) motif. Its homodimerization Kd is 184nM and its best heterodimer is with CEBPG (<1nM) (PMID: 23661758).
BATF2 bZIP Yes Likely to be sequence specific TF 2 Obligate heteromer No motif Part of AP-1 complex - there is no evidence it can bind on its own as a homodimer.
BATF3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Transfac motif is dubious.
BEND4 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Lacks the basic region of the bZIP domain.
CCDC3 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif bZIP domain is truncated and lacks the DNA-contacting residues.
CCDC83 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif bZIP domains are truncated, such that they are likely just coiled-coiled regions with no DNA-binding ability.
CEBPA bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
CEBPB bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CEBPD bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro CEBPD binds as both a homodimer and as a heterdimer with other C/EBP TFs (PMID: 1884998; PMID: 12805554).
CEBPE bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Also forms heterodimers.
CEBPG bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB3L1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB3L2 bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
CREB3L3 bZIP Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Gel-shift and reporter experiments demonstrate that CREB3L3 is a TF (PMID: 11353085).
CREB3L4 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREB5 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
CREBL2 bZIP Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
CREBRF bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Tested on HT-SELEX and did not yield a motif. Binds to CREB3 and represses the unfolded protein response (PMID: 18391022).
CREBZF bZIP Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
CREM bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
DBP bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
DDIT3 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Has strong preference for forming heterodimers with BATF; DBP; HLF; CEBP[ABCD] over homodimerization (PMID: 12805554).
FOS bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FOSB bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FOSL1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FOSL2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Also forms heterodimers.
GULP1 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
HLF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HOOK2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
IQGAP1 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif bZIP domain in the protein is just a fragment.
JDP2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
JUN bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
JUNB bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Prefers forming heterodimers with FOS; FOSB; FOSL1 and FOSL2 over homodimers (PMID:12805554); but, clearly can bind DNA specifically in vitro.
JUND bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KIF15 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Has a bZIP like fragment that lacks the basic region required for DNA binding and a STE-domain that is classified as a potential DBD in CIS-BP. It is a kinesin operating in the microtubule system (PMID: 24419385)
KRT13 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
MAF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFA bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFB bZIP Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro PDB:2WTY is a homodimer crystallised with TAATTGCTGACTCAGCAAAT sequence
MAFF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFG bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MAFK bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MORC3 bZIP No ssDNA/RNA binding 4 Not a DNA binding protein No motif Lacks a canonical bZIP DBD but: regulates TP53 activity (PMID: 17332504]), binds RNA in vitro (PMID: 11927593), and may be required for influenza A transcription during viral infection (PMID: 26202233).
NDC80 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
NFE2 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NFE2L1 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Tested on HT-SELEX and PBM. Neither yielded a motif. Likely an obligate heteromer (PMID: 23661758).
NFE2L2 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Has been tested by both PBM and HT-SELEX. Neither yielded a motif. Likely obligate heteromer.
NFE2L3 bZIP Yes Known motif 2 Obligate heteromer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Tested on HT-SELEX and PBM. Neither yielded a motif. Likely an obligate heteromer (PMID: 23661758). Strong preference for forming heterodimers with MAFG and MAFK over homodimers (PMID: 12805554).
NFIL3 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
NRBF2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Based on the alignments, the protein is only weakly related to the other bZIP proteins and lacks the basic region required for DNA binding
NRL bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PPP1R21 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Protein lacks the basic region these proteins use to contact the DNA
RAB11FIP4 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Likely false-positive - appears to function primarily in the cytoplasm (PMID: 12470645).
RNF219 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Not a proper bZIP; contains only a small leucine zipper region but lacks the DNA-interfacing basic part.
SCOC bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Not a proper bZIP; contains only a small leucine zipper region but lacks the DNA-interfacing basic part.
TEF bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
TRAK2 bZIP No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif The bZIP domain is only a partial 40AA sequence that will not bind DNA.
XBP1 bZIP Yes Known motif 1 Monomer or homomultimer High-throughput in vitro