Collection of 747 putative C2H2 ZF human TFs out of 761 considered proteins

No Alignment available for C2H2ZF
Ensembl ID HGNC symbol DBD Family Is TF? TF Assessment Binding Mode Motif Status Notes Comments
AC008770.3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AC092835.1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif KRAB C2H2 Protein
AC138696.1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
AEBP2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
AKAP8 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain (PMID: 26683827) uses SELEX to show binding to G/C rich DNA, and confirms association with rDNA promoters. Also claims it has a C2H2 domain. Interpro says it has a C2H2 AKAP95-type 1 and a C2H2 AKAP95-type 2 domain. SMART does identify a single C2H2 domain.
AKAP8L C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain This is homologous to the AKAP8/AKAP95 protein. which has been shown by SELEX to bind GC rich sequences (PMID: 26683827).
ANKZF1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ATMIN C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
BCL11A C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
BCL11B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BCL6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BCL6B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
BNC1 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
BNC2 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source Has a putative AT-hook
CASZ1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
CCDC17 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
CHAMP1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
CPXCR1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
CTCF C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Has a putative AT-hook
CTCFL C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
DPF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro This protein contains C2H2 ZFs missed by Pfam scanning.
DPF3 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro Single C2H2 domain Single C2H2 ZF. PHD domains mediate recognition of acetylated histones (PMID: 20613843); unclear if the ZF contributes DNA-binding specificity to the interaction.
DZIP1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain; Has a putative AT-hook
E4F1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
EEA1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Based on (PMID: 20534488), the protein has a C2H2 ZF domain; but it uses the domain for contacting RAB5A rather than for binding DNA.
EGR1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
EGR2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Binds HOX4A promoter (PMID:21836637)
EGR3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
EGR4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
FAM170A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Degenerate C2H2-ZFP. Localizes to the nucleus and overexpression upregulates other genes (PMID: 20162441).
FEZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
FEZF2 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
FIZ1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Protein has a decent cassette of C2H2 ZF domains (not all are detected by Pfam). It has been also shown to interact with homeodomain protein CRX (PMID: 18854042) and MAF-subtype bZIP protein NRL (PMID: 12566383).
GFI1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GFI1B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLI1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
GLI2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLI3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLI4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect Protein is not closely homologous to GLI1-3 proteins.
GLIS1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLIS2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GLIS3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
GTF3A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
GZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HIC1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HIC2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HINFP C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
HIVEP1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HIVEP2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
HIVEP3 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source Has a putative AT-hook Binds to NFKB-like consensus sequence to repress transcription (PMID: 21189157). PWMs for HIVEP1 and 2 in Transfac and Hocomoco are also NFKB-like.
HKR1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
IKZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
IKZF2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
IKZF3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
IKZF4 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
IKZF5 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
INSM1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
INSM2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
JAZF1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
KAT7 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
KCMF1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain No evidence of DNA-binding in the literature; and has evidence of E3 ligase activity (PMID:15581609).
KIN C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Binds curved DNA (PMID: 8078469).
KLF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF10 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF11 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF13 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF15 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF16 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF17 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Binds as a monomer and as a dimer (PMID: 25575120).
KLF6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
KLF7 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
KLF8 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
KLF9 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
L3MBTL1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Histone modifier; polycomb protein.
L3MBTL3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Histone modifier; polycomb protein.
L3MBTL4 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Histone modifier; polycomb protein.
MAZ C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
MECOM C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
MTF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
MYNN C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
MYT1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Crystal structure (PDB:2JX1) has GTGAACTTTCGGT DNA; similar to MYT1L SELEX and PBM sites.
MYT1L C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
MZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
NUFIP1 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif Single C2H2 domain This is a known RNA-binding protein with a single C2H2 domain. TF-CAT considered it a candidate TF; but in the ten years since; no such evidence has emerged.
OSR1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OSR2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OVOL1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OVOL2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
OVOL3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PEG3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif SCAN C2H2 ZF Protein.
PLAG1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PLAGL1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
PLAGL2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PRDM1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PRDM10 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
PRDM12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
PRDM13 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PRDM14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
PRDM15 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
PRDM16 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
PRDM2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has been suggested to function as a histone methyltransferase (PMID: 15282304), but it has a decent set of C2H2 ZF domains and could thus bind DNA independently.
PRDM4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
PRDM5 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a nice cassette of C2H2 ZF domains. Moreover, (PMID: 17636019) has performed SELEX for it and validated the result.
PRDM6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
PRDM8 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
PRDM9 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
PRMT3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Has a single C2H2 ZF (PMID: 10931850).
RBAK C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
RBSN C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Potential false positive - protein functions in membrane trafficking.
REPIN1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds DNA specifically based on EMSA and nuclease footprinting (PMID: 10606657).
REST C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
RLF C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
RREB1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
SALL1 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
SALL2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
SALL3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
SALL4 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
SCRT1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SCRT2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SLC2A4RG C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Two papers demonstrate a bit of evidence for DNA binding (PMID:10825161 and PMID: 14625278 ).
SNAI1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SNAI2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SNAI3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Transfac motif has some similarity to known Sp1 TF motifs from multiple species and sources
SP6 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
SP7 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
SP8 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
SP9 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ST18 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
TRAFD1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Possible false positive: the protein negatively regulates IRF3 and NFKB but there is no evidence for DNA-binding and it is likely to operate upstream on the signalling cascade (PMID:18849341).
TSHZ1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
TSHZ2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Also contains an atypical homodomain (Uniprot) not identified by Pfam.
TSHZ3 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif The C2H2 domains are too spread out to be credible; but there is also a homodomain. Seems more likely than not that it binds DNA.
VEZF1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
WIZ C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook Regulates the G9aGLP complex for gene repression; has a ChIP-seq derived DNA-binding motif (PMID:25789554).
WT1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Crystal structure (PDB:2JP9) is with dsDNA GCGCAGACGCCCCCGCG, which is consistent with the PWMs
YY1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
YY2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ZBTB10 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB11 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZBTB12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB16 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZBTB17 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB18 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB20 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB21 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB22 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB25 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB26 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ZBTB32 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB33 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
ZBTB34 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB37 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB38 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif It has a decent cassette of znfC2H2 domains and a BTB homodimerization domain. Requires CpG methylation for binding into a site in MYOG-promoter (PMID: 21625269).
ZBTB39 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZBTB40 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB41 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB42 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZBTB43 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB44 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB45 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB46 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Specificity is unknown; functions in dendritic cells (PMID: 22615130).
ZBTB47 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZBTB48 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZBTB49 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB5 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Binds to GATCGGGCGGGGCGGTTGTATATCA; GATCCGTTAGAGGAAGAAGACTGGGCATGTCTG and GATCCATCAGGAACATGTCCCAACATGTTGAGCTC based on EMSA using recombinant protein (PMID: 19491398).
ZBTB6 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZBTB7A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB7B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB7C C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZBTB8A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a two znfC2H2 domains and a BTB-domain
ZBTB8B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a BTB homodimerization domain
ZBTB9 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has two znfC2H2 domains and a BTB-domain that typically mediates homotypic dimerization
ZFAT C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
ZFP1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZFP14 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP2 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZFP28 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE); Has a putative AT-hook
ZFP3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP30 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ZFP37 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZFP41 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZFP42 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZFP57 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect Recognizes CpG methylated ACTGCGGCAAT site based on structure 4GZN
ZFP62 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZFP64 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZFP69 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP69B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP82 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP90 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZFP91 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible false positive. An Atypical E3 ubiquitin-protein ligase that mediates Lys-63-linked ubiquitination of MAP3K14/NIK; leading to stabilization and activation of MAP3K14/NIK. It thereby acts as an activator of the non-canonical NF-kappa-B2/NFKB2 pathway (PMID: 20682767).
ZFP92 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZFPL1 C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Protein is a Golgi apparatus integral membrane protein with RING-type zinc fingers (PMID:18323775 ).
ZFPM1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZFPM2 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif FOG-proteins use some of their zinc-fingers to interact with the GATA proteins. Other C2H2 ZFs are probably also capable of binding DNA (PMID: 10329627).
ZFR C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif
ZFR2 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif ZFR2 contains only RNA-binding zinc fingers
ZFX C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZFY C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZIC1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIC2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer 100 perc ID - in vitro
ZIC3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIC4 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIC5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZIK1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZIM2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect Binds GKGGSWST consensus with GTGGCAGT as the optimal site based on competition EMSA (PMID: 26692216).
ZIM3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZKSCAN1 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZKSCAN2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZKSCAN3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZKSCAN4 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZKSCAN5 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZKSCAN7 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZKSCAN8 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZMAT1 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Possible RBP.
ZMAT3 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif Protein binds RNA (PMID: 19805223 and PMID: 16844115).
ZMAT4 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible RBP.
ZNF10 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF100 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF101 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF106 C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif C2H2 ZFs are not present in most isoforms; of which most contain WD40 repeats. Previous annotations (TFCat) suggest role as a cofactor (PMID: 15833274).
ZNF107 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF112 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a nice cassette of znfC2H2 domains and a KRAB-domain; virtually nothing is known about it.
ZNF114 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF117 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZNF12 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF121 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF124 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF131 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Evidence for DNA binding (PMID: 20303951 ).
ZNF132 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF133 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF134 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF135 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF136 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF138 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF14 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF140 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF141 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF142 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF143 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF146 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF148 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF154 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF155 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF157 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF16 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF160 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF165 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a SCAN-domain and that it appears to be expressed commonly in urinary bladder cancers PMID: 25214475
ZNF169 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF17 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF174 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF175 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF177 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF18 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF180 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF181 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF182 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF184 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF189 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF19 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF195 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Kruppel family C2H2 ZF.
ZNF197 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF2 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF20 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF200 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF202 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF205 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF207 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF208 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF211 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF212 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF213 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE); Has a putative AT-hook
ZNF214 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF215 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF217 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Based on (PDB: 3UK3) this protein has at least two DNA binding znf domains. In vitro evidence for DNA binding (PMID:17130829).
ZNF219 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Binds CCCCCA based on SELEX (PMID: 14621294).
ZNF22 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF221 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF222 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF223 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF224 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF225 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF226 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF227 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF229 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF23 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF230 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has nice array of znf domains and a KRAB domain
ZNF232 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF233 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF234 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF235 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF236 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF239 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds TAAAGGCT based on EMSA (PMID: 11278819).
ZNF24 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF248 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF25 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF250 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF251 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF253 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF254 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF256 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF257 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF26 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF260 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF263 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF264 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF266 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF267 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF268 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Contains znfC2H2 domains and a KRAB-domain; linked to cervical cancer through effects on NFKB-signaling (PMID: 23091055).
ZNF273 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF274 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF275 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF276 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF28 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF280A C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF280B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF280C C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF280D C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF281 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF282 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF283 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF284 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF285 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF286A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF286B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF287 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF292 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF296 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF3 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF30 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF300 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF302 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF304 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF311 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF316 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF317 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF318 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible RNA-binding protein; it has two u1 type ZNF domains (PMID: 25057009).
ZNF319 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF32 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF320 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF322 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF324 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF324B C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF326 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif ZNF326 is a member of the DBIRD complex that regulates splicing by binding to PolII in an RNA-independant manner (PMID:22446626).
ZNF329 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF331 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF333 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF334 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF335 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
ZNF337 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF33A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF33B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF34 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF341 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF343 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF345 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF346 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Binds dsDNA with low affinity and no discernible specificity (PMID: 24521053).
ZNF347 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF35 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF350 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF354A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF354B C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF354C C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
ZNF355P C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Pseudogene
ZNF358 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF362 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF365 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Also contains a Ku C terminal like domain that is thought to be involved in DNA-damage repair pathways.
ZNF366 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif This protein has been shown to complex with and function as a corepressor for ESR1 (PMID: 17085477) and glucocorticoid receptor (PMID: 23440419). It has a nice set of znfs and could thus well bind DNA independently.
ZNF367 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook Virtually nothing is known for this protein except that it has two znfC2H2 domains next to each other
ZNF37A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF382 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF383 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF384 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF385A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF385B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF385C C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF385D C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF391 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF394 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF395 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain Contains a single ZF (string matching on Uniprot) that is not identified using Pfam HMM thresholds. Shown to bind a short DNA sequence (GCCGGCG) by EMSA and DNase I footprinting (PMID:14625278).
ZNF396 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF397 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and that it binds on centromeric regions PMID: 18369653
ZNF398 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF404 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF407 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook Protein has a decent cassette of znfC2H2 domains; a study links it in regulation of glucose intake receptor GLUT4 (PMID: 25596527).
ZNF408 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF41 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF410 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF414 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Its on the low end of confidence that its a TF; since most of the domains are variants of C2H2; but its more likely than not since they are in a row.
ZNF415 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF416 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
ZNF417 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF418 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF419 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF420 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF423 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF425 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF426 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF428 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ZNF429 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF43 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF430 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF431 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF432 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF433 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF436 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF438 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has two znfC2H2 domains and that it represses transcription in a reporter assay PMID: 17669267
ZNF439 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF44 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF440 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF441 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF442 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF443 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF444 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF445 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF446 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Contains three znfC2H2 domains and represses transcription when expressed as GAL4 fusion (PMID:15936718).
ZNF449 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF45 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF451 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF454 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF460 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF461 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Protein has a decent cassette of znfC2H2 domains and a KRAB-domain. It has been shown also to operate as a corepressor of NR5A1, where the KRAB-domain ).mediates both the interaction to NR5A1 and to HDAC2 (PMID: 16595694
ZNF462 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has many znfC2H2 like domains that are however not in tight arrays but interspersed throughout the sequence
ZNF467 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF468 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF469 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook
ZNF470 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a possible role in chondrocytes (PMID: 15302581). It has a decent cassette of znfC2H2 domains and a KRAB-domain.
ZNF471 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF473 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF474 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ZNF479 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF48 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF480 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF483 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF484 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF485 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF486 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF487 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Single C2H2 domain; Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF488 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has two znfC2H2 domains
ZNF490 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF491 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF492 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF493 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF496 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF497 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF500 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF501 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF502 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF503 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ZNF506 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE) Has a nice cassette of znfC2H2 domains and a KRAB domain
ZNF507 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF510 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has decent cassettes of znfC2H2 domains
ZNF511 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF512B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a putative AT-hook Protein has znfC2H2 domains but they are fragmented rather than making decent cassettes
ZNF513 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF514 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF516 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF517 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF518A C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and that it interacts with polycomb repressor complex 2 PMID: 25680957
ZNF518B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF519 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF521 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF525 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF526 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF527 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF528 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF529 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF530 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF532 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has decent cassettes of znfC2H2 domains
ZNF534 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF536 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF540 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF542P C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Pseudogene
ZNF543 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF544 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF546 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF547 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF548 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF549 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF550 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF551 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF552 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF554 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF555 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF556 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF557 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF558 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF559 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF560 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF561 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF562 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF563 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF564 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF565 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF566 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF567 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF568 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF569 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF57 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Has a nice cassette of znfC2H2 domains and has been shown to be expressed in many tissues and to be able to repress transcription (PMID: 20356463).
ZNF570 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF571 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF572 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF573 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF574 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF575 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF576 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF577 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF578 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF579 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF580 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF581 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF582 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF583 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF584 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF585A C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF585B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF586 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF587 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF587B C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF589 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain
ZNF592 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF593 C2H2 ZF No Unlikely to be sequence specific TF 4 Not a DNA binding protein No motif Protein has a single atypical znfC2H2 domain that has been shown to inhibit binding of POU2F2 to DNA by interacting with POU2F2 (PMID: 18287285).
ZNF594 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF595 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF596 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF597 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF598 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF599 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF600 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF605 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF606 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF607 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF608 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ZNF609 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ZNF610 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF611 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF613 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF614 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF615 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF616 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF618 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF619 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF620 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF621 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Motif obtained from MEME - not supported by recognition code (RCADE) and may be inaccurate or indirect
ZNF622 C2H2 ZF No ssDNA/RNA binding 4 Not a DNA binding protein No motif ZNF622 lacks canonical Pfam matches to C2H2 domains and appears to have better homology to U1-type 1 ZFs involved in RNA recognition. Previous evidence for TF activity (PMID:12645566) was based on transcriptional regulation; and not DNA-binding.
ZNF623 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF624 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF625 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains and a KRAB-domain
ZNF626 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF627 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF628 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source Only known motifs are from Transfac or HocoMoco - origin is uncertain Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains. The transfac model doesnt look like a common suspect
ZNF629 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF630 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF639 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Promotes transcription of HIV genes (PMID: 24204263).
ZNF641 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF644 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Possible false positive. Arrangement of C2H2 domains seems inconsistent with DNA binding.
ZNF645 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Single C2H2 domain
ZNF646 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF648 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF649 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF652 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer High-throughput in vitro
ZNF654 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF655 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro Virtually nothing is known for this protein except that it has a decent cassette of znfC2H2 domains
ZNF658 C2H2 ZF Yes Known motif 1 Monomer or homomultimer In vivo/Misc source
ZNF66 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF660 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro
ZNF662 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF664 C2H2 ZF Yes Inferred motif 1 Monomer or homomultimer In vivo/Misc source
ZNF665 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF667 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)
ZNF668 C2H2 ZF Yes Likely to be sequence specific TF 1 Monomer or homomultimer No motif
ZNF669 C2H2 ZF Yes Known motif 1 Monomer or homomultimer High-throughput in vitro ChIP-seq motif is consistent with recognition code (RCADE)